Posted by on 4 grudnia 2018

Genomowy DNA był amplifikowany przez łańcuchową reakcję polimerazy (PCR), jak opisano w innym miejscu. 28 Dziesięć par starterów użyto do wytworzenia 10 zachodzących na siebie produktów PCR obejmujących cały region kodujący, region 5 nieulegający translacji, połączenia splicingowe egzon-intron i 521 pary zasad (bp) regionu regulatorowego genu receptora .3-adrenergicznego17,20,29 (oraz dane zdeponowane w Krajowej Służbie Pomocniczych Publikacji, NAPS). W celu analizy jednoniciowych konformacyjnych polimorfizmów produkty PCR znakowano radioaktywnie przez dodanie [.-32P] trifosforanu deoksycytydyny do mieszaniny reakcyjnej. Zdenaturowane produkty PCR naniesiono na żel poliakryloamidowy (MDE, AT Biochemicals, Malvern, Pa.) I poddano elektroforezie przy 4 do 6 W przez 18 do 20 godzin w czterech warunkach żelu: zi bez 10% glicerolu w 4 ° C i w 25 ° C. 30 Żel wysuszono próżniowo i przeprowadzono autoradiografię. Analiza sekwencji dideoksy
Warianty wykryte przez analizę jednoniciowych konformacyjnych polimorfizmów poddano bezpośredniej analizie sekwencji dideoksy z asymetrycznymi zestawami PCR28 i Seąuenase Version 2.0 (United States Biochemicals, Cleveland). Zmiany zasad potwierdzono przez sekwencjonowanie przeciwległych nici i trawienie enzymami restrykcyjnymi.
Wykrywanie zmutowanego receptora przez hybrydyzację z oligonukleotydami specyficznymi dla allelu
Fragment 367-bp genu receptora .3-adrenergicznego obejmujący miejsce mutacji amplifikowano przez PCR ze starterami 5 TTCCTTCTTTCCCTACCGCCC3 i 5 GCAGCCAGTGGCGCCCAACGG3 . Produkty PCR przeniesiono w dwóch powtórzeniach na membrany nylonowe. Hybrydyzację przeprowadzono z użyciem znakowanych radioaktywnie 32P oligonukleotydów odpowiadających normalnej sekwencji genu receptora .3-adrenergicznego (5 CATCGCCTGGACTCCGA3 , sondę dla Trp64) lub sekwencji genu receptora .3-adrenergicznego Trp64Arg (5 CATCGCCCGGACTCCGA3 sonda dla Arg64). Błony przemyto następnie dwukrotnie w 2x chlorek sodu-fosforan sodu-EDTA (SSPE) (1 x SSPE to 150 mM chlorek sodu, 10 mM fosforan sodu i 1,25 mM EDTA, pH 7,4) i 0,05% dodecylosiarczanu sodu w 60 ° C (sonda Trp64) lub 62 ° C (sonda Arg64) przez 15 minut i przeprowadzono autoradiografię.
Analiza statystyczna
W badaniach nad powiązaniem zmiennych z genotypem przeprowadzono testy chi-kwadrat. W analizie cech ilościowych zastosowano analizę wariancji i, w stosownych przypadkach, zmienne towarzyszące uwzględniono w modelach.
Wyniki
Analiza jednorodnych polimorfizmów konformacyjnych
Rysunek 1. Rysunek 1. Identyfikacja mutacji Trp64Arg w genie receptora .3-adrenergicznego. Panel A pokazuje autoradiogram analizy polimorfizmów konformacyjnych w pojedynczej nici DNA z regionu genu receptora .3-adrenergicznego u 7 z 10 cukrzycowych Indian Pima. Strzałka pokazuje wariantowy wzór na ścieżkach 2 do 6. Panel B pokazuje autoradiografy uzyskane przez bezpośrednią analizę sekwencji regionu genu, z normalną sekwencją po lewej stronie. Sekwencjonowanie jednego z produktów PCR, które ujawniło wariantowy wzór w Panelu A, pokazało zarówno tymidynę (T), jak i cytozynę (C) w pozycji nukleotydowej 190
[patrz też: enelmed warszawa, odbudowa kości szczęki, spiaczka cukrzycowa objawy ]

Powiązane tematy z artykułem: enelmed warszawa odbudowa kości szczęki spiaczka cukrzycowa objawy

Posted by on 4 grudnia 2018

Genomowy DNA był amplifikowany przez łańcuchową reakcję polimerazy (PCR), jak opisano w innym miejscu. 28 Dziesięć par starterów użyto do wytworzenia 10 zachodzących na siebie produktów PCR obejmujących cały region kodujący, region 5 nieulegający translacji, połączenia splicingowe egzon-intron i 521 pary zasad (bp) regionu regulatorowego genu receptora .3-adrenergicznego17,20,29 (oraz dane zdeponowane w Krajowej Służbie Pomocniczych Publikacji, NAPS). W celu analizy jednoniciowych konformacyjnych polimorfizmów produkty PCR znakowano radioaktywnie przez dodanie [.-32P] trifosforanu deoksycytydyny do mieszaniny reakcyjnej. Zdenaturowane produkty PCR naniesiono na żel poliakryloamidowy (MDE, AT Biochemicals, Malvern, Pa.) I poddano elektroforezie przy 4 do 6 W przez 18 do 20 godzin w czterech warunkach żelu: zi bez 10% glicerolu w 4 ° C i w 25 ° C. 30 Żel wysuszono próżniowo i przeprowadzono autoradiografię. Analiza sekwencji dideoksy
Warianty wykryte przez analizę jednoniciowych konformacyjnych polimorfizmów poddano bezpośredniej analizie sekwencji dideoksy z asymetrycznymi zestawami PCR28 i Seąuenase Version 2.0 (United States Biochemicals, Cleveland). Zmiany zasad potwierdzono przez sekwencjonowanie przeciwległych nici i trawienie enzymami restrykcyjnymi.
Wykrywanie zmutowanego receptora przez hybrydyzację z oligonukleotydami specyficznymi dla allelu
Fragment 367-bp genu receptora .3-adrenergicznego obejmujący miejsce mutacji amplifikowano przez PCR ze starterami 5 TTCCTTCTTTCCCTACCGCCC3 i 5 GCAGCCAGTGGCGCCCAACGG3 . Produkty PCR przeniesiono w dwóch powtórzeniach na membrany nylonowe. Hybrydyzację przeprowadzono z użyciem znakowanych radioaktywnie 32P oligonukleotydów odpowiadających normalnej sekwencji genu receptora .3-adrenergicznego (5 CATCGCCTGGACTCCGA3 , sondę dla Trp64) lub sekwencji genu receptora .3-adrenergicznego Trp64Arg (5 CATCGCCCGGACTCCGA3 sonda dla Arg64). Błony przemyto następnie dwukrotnie w 2x chlorek sodu-fosforan sodu-EDTA (SSPE) (1 x SSPE to 150 mM chlorek sodu, 10 mM fosforan sodu i 1,25 mM EDTA, pH 7,4) i 0,05% dodecylosiarczanu sodu w 60 ° C (sonda Trp64) lub 62 ° C (sonda Arg64) przez 15 minut i przeprowadzono autoradiografię.
Analiza statystyczna
W badaniach nad powiązaniem zmiennych z genotypem przeprowadzono testy chi-kwadrat. W analizie cech ilościowych zastosowano analizę wariancji i, w stosownych przypadkach, zmienne towarzyszące uwzględniono w modelach.
Wyniki
Analiza jednorodnych polimorfizmów konformacyjnych
Rysunek 1. Rysunek 1. Identyfikacja mutacji Trp64Arg w genie receptora .3-adrenergicznego. Panel A pokazuje autoradiogram analizy polimorfizmów konformacyjnych w pojedynczej nici DNA z regionu genu receptora .3-adrenergicznego u 7 z 10 cukrzycowych Indian Pima. Strzałka pokazuje wariantowy wzór na ścieżkach 2 do 6. Panel B pokazuje autoradiografy uzyskane przez bezpośrednią analizę sekwencji regionu genu, z normalną sekwencją po lewej stronie. Sekwencjonowanie jednego z produktów PCR, które ujawniło wariantowy wzór w Panelu A, pokazało zarówno tymidynę (T), jak i cytozynę (C) w pozycji nukleotydowej 190
[patrz też: enelmed warszawa, odbudowa kości szczęki, spiaczka cukrzycowa objawy ]

Powiązane tematy z artykułem: enelmed warszawa odbudowa kości szczęki spiaczka cukrzycowa objawy